missing translation for 'onlineSavingsMsg'
Learn More

Cytiva GST Vector Primers for Sequencing

Product Code. 10774157 Shop All Cytiva Products
Change view
Click to view available options
Primer:
pGEX 3′ Sequencing
pGEX 5′ Sequencing
Unit Size:
Each
2 product options available for selection
Product selection table with 2 available options. Use arrow keys to navigate and Enter or Space to select.
Product Code. Primer unitSize
10774157 pGEX 5′ Sequencing Each
10784157 pGEX 3′ Sequencing Each
Use arrow keys to navigate between rows. Press Enter or Space to select a product option. 2 options available.
2 options
This item is not returnable. View return policy
Product Code. 10774157 Supplier Cytiva Supplier No. 27141001

Please to purchase this item. Need a web account? Register with us today!

This item has been discontinued and is no longer available. View the product for possible alternatives or contact our Technical Support team on 056 260 260 for assistance.
View alternative products

This item is not returnable. View return policy

Forward and reverse sequencing primers flanking the multiple cloning site of all pGEX vectors in the GST fusion system, for verification of inserted DNA sequence

  • Provided ready for immediate use
  • pGEX 5’ Sequencing Primer: 5’-d[GGGCTGGCAAGCCACGTTTGGTG]-3’
  • pGEX 3' Sequencing Primer: 5’-d[CCGGGAGCTGCATGTGTCAGAGG]-3’

TRUSTED_SUSTAINABILITY

Specifications

For Use With (Equipment) Glutathione S-transferase (GST) gene fusion system
Content And Storage -20°C
Primer pGEX 5′ Sequencing
Quantity 260 U
For Use With (Application) Ready-to-use in sequencing double-stranded DNA inserted into pGEX Vectors
Product Title
Select an issue

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.