missing translation for 'onlineSavingsMsg'
Learn More

Invitrogen™ Gateway™ Vector Conversion System with One Shot™ ccdB Survival Cells

Código de producto. 10368342
missing translation for 'changeView'
missing translation for 'orderingAttributeHoverText'
Quantity:
1 kit
missing translation for 'unitSize'
1 set
1 product options available for selection
Product selection table with 1 available options. Use arrow keys to navigate and Enter or Space to select.
Código de producto. Quantity unitSize
10368342 1 kit 1 set
Use arrow keys to navigate between rows. Press Enter or Space to select a product option. 1 options available.
1 missing translation for 'options'
Este artículo no se puede devolver. Vea la política de devoluciones
Código de producto. 10368342 missing translation for 'mfr' Invitrogen™ missing translation for 'supplierNo' 11828029

Please to purchase this item. Need a web account? Register with us today!

Este artículo no se puede devolver. Vea la política de devoluciones

Includes

Gateway Reading Frame Cassettes A, B, and C.1, pENTR™-gus positive control, and ccdB Survival Cells.

Designed to convert any vector into Gateway destination vector using restriction endonucleases and ligase

  • Gateway cassette containing attR recombination sites flanking ccdB gene (1) and chloramphenicol-resistance gene are blunt-end cloned into multiple cloning site of any vector ccdB
  • Survival 2 competent cells allow propagation of Gateway vectors containing ccdB gene
  • Three cassettes to construct a destination vector in correct reading frame; Each cassette has unique restriction site to easily distinguish cassettes and screen for correct orientation

Cloning,Gateway Cloning,Gateway Vector Conversion Systems

TRUSTED_SUSTAINABILITY

Especificaciones

Product Type Vector Conversion System
Content And Storage The Gateway™ Vector Conversion System contains Gateway™ Reading Frame Cassettes A, B, and C.1, pENTR™-gus positive control, and One Shot™ ccdB Survival Cells. Store DNA at -20°C and competent cells at -80°C.
Antibiotic Resistance Bacterial Chloramphenicol (CmR)
Bacterial or Yeast Strain ccdB Survival™ 2
Cloning Method Gateway
Quantity 1 kit
Product Line One Shot
I am using your Gateway conversion kit to adapt my own vector. What is the difference between the A, B, and C reading frame cassettes?

The A, B, and C reading frame cassettes differ by 1 nucleotide each, allowing you to generate attR sites in all 3 reading frames. Each reading frame cassette contains a unique restriction site to allow you to distinguish between them (please see table on Page 3 of the Gateway Vector Conversion System with One Shot ccdB Survival 2 T1R Competent Cells manual).

How large of a PCR product can I recombine with a pDONR vector via BP cloning? Does the same apply for TOPO-adapted Entry vectors?

There is no theoretical limit to insert size for a BP reaction with a pDONR vector. Maximum size tested in-house is 12 kb. TOPO vectors are more sensitive to insert size and 3-5 kb is the upper limit for decent cloning efficiency.

How should I clean up my attB-PCR product?

After generating your attB-PCR product, we recommend purifying it to remove PCR buffer, unincorporated dNTPs, attB primers, and any attB primer-dimers. Primers and primer-dimers can recombine efficiently with the Donor vector in the BP reaction and may increase background after transformation into E. coli, whereas leftover PCR buffer may inhibit the BP reaction. Standard PCR product purification protocols using phenol/chloroform extraction followed by ammonium acetate and ethanol or isopropanol precipitation are not recommended for purification of the attB-PCR product as these protocols generally have exclusion limits of less than 100 bp and do not efficiently remove large primer-dimer products. We recommend a PEG purification protocol (see page 17 of the Gateway Technology with Clonase II manual). If you use the above protocol and your attB-PCR product is still not suitably purified, you may further gel-purify the product. We recommend using the PureLink Quick Gel Extraction kit.

I'm trying to propagate my Gateway destination vector and am not seeing any colonies. What should I do?

Check the genotype of the cell strain you are using. Our Gateway destination vectors typically contain a ccdB cassette, which, if uninterrupted, will inhibit E. coli growth. Therefore, un-cloned vectors should be propagated in a ccdB survival cell strain, such as our ccdB Survival 2 T1R competent cells.

What is the difference between LR Clonase II and LR Clonase II Plus?

LR Clonase II Plus contains an optimized formulation of recombination enzymes for use in MultiSite Gateway LR reactions. LR Clonase and LR Clonase II enzyme mixes are not recommended for MultiSite Gateway LR recombination reactions, but LR Clonase II Plus is compatible with both multi-site and single-site LR recombination reactions.

What is the purpose of the Proteinase K step following a Gateway LR Recombination reaction, and is it critical to the results?

When the LR reaction is complete, the reaction is stopped with Proteinase K and transformed into E. coli resulting in an expression clone containing a gene of interest. A typical LR reaction followed by Proteinase K treatment yields about 35,000 to 150,000 colonies per 20ul reaction. Without the Proteinase K treatment, up to a 10 fold reduction in the number of colonies can be observed. Despite this reduction, there are often still enough colonies containing the gene of interest to proceed with your experiment, so the Proteinase K step can be left out after the LR reaction is complete if necessary.

Can I go directly from a pENTR/D-TOPO reaction into an LR Clonase Reaction without first purifying the DNA?

In most cases, there will not be enough pENTR vector DNA present to go directly from TOPO cloning into an LR reaction. You need between 100-300 ng of pENTR vector for an efficient LR reaction, and miniprep of a colony from the TOPO transformation is necessary to obtain that much DNA. However, if you want to try it, here are some recommendations for attempting to go straight into LR reactions from the TOPO reaction using pENTR/D, or SD TOPO, or pCR8/GW/TOPO vectors:

1. Heat inactivate the topoisomerase after the TOPO cloning reaction by incubating the reaction at 85 degrees C for 15 minutes.
2. Use the entire reaction (6 µL) in the LR clonase reaction. No purification steps are necessary.
3. Divide the completed LR reaction into 4 tubes and carry out transformations with each tube. You cannot transform entire 20 µL reaction in one transformation, and we have not tried ethanol precipitation and then a single transformation.

When attempting this protocol, we observed very low efficiencies (~10 colonies/plate). So just be aware that while technically possible, going directly into an LR reaction from a TOPO reaction is very inefficient and will result in a very low colony number, if any at all.

Can N-terminal or C-terminal tags be attached to a Gateway Entry clone?

To have an N-terminal tag, the gene of interest must be in the correct reading frame when using non-TOPO adapted Gateway entry vectors. All TOPO adapted Gateway Entry vectors will automatically put the insert into the correct reading frame, and to add the N-terminal tag you simply recombine with a destination vector that has N-terminal tag.

To attach a C-terminal tag to your gene of interest, the insert must lack its stop codon, and be in the correct reading frame for compatibility with our C-terminal tagged destination vectors. Again, TOPO adapted Gateway Entry vectors will automatically put the insert into the correct reading frame. If you do not want the C-terminal tag to be expressed, simply include a stop codon at the end of the insert that is in frame with the initial ATG.

Generally, you need to choose a destination vector before you design and clone your insert into the Entry vector. This will determine whether you need to include an initiating ATG or stop codon with your insert.

Can an attB-PCR product be cloned directly into an expression (Gateway Destination) vector?

No, not directly. The attB-PCR product must first be cloned, via a BP Clonase reaction, into a pDONR vector which creates an "Entry Clone" with attL sites. This clone can then be recombined, via an LR Clonase reaction, with a Destination vector containing attR sites. However, It is possible to perform both of these reactions in one step using the "One-Tube Protocol" described in the manual entitled "Gateway Technology with Clonase II".

Can Gateway technology be used to express two proteins from the same vector?

Yes, this can be done using the Multisite Gateway Technology. MultiSite Gateway Pro Technology enables you to efficiently and conveniently assemble multiple DNA fragments - including genes of interest, promoters, and IRES sequences - in the desired order and orientation into a Gateway Expression vector. Using specifically designed att sites for recombinational cloning, you can clone two, three, or four DNA fragments into any Gateway Destination vector containing attR1 and attR2 sites. The resulting expression clone is ready for downstream expression and analysis applications.

What is the efficiency of recombination in the Gateway system?

For the BP reaction, approximately 5-10% of the starting material is converted into product. For the LR reaction, approximately 30% of the starting material is converted into product.

Are there common restriction sites that can be used to excise a gene out of a Gateway plasmid?

The core region of the att sites contains the recognition sequence for the restriction enzyme BsrGI. Provided there are no BsrGI sites in the insert, this enzyme can be used to excise the full gene from most Gateway plasmids. The BsrGI recognition site is 5'-TGTACA and is found in both att sites flanking the insertion site.

If a different restriction site is desired, the appropriate sequence should be incorporated into your insert by PCR.

Do I have to synthesize new attB primers (29 base attB primer + my specific sequence primer) each time I want to make an attB PCR product, or do you have truncated attB primers that work together with adapter attB primers to get a complete attB sequence?

We do have an alternative method called the "attB Adapter PCR" Protocol in which you make your gene specific primer with only 12 additional attB bases and use attB universal adapter primers. This protocol allows for shorter primers to amplify attB-PCR products by utilizing four primers instead of the usual two in a PCR reaction. You can find the sequence of these primers in the protocol on page 45 of the "Gateway Technology with Clonase II" manual.

There is a protocol in which all 4 primers mentioned above are in a single PCR reaction. You can find this protocol at in the following article: Quest vol. 1, Issue 2, 2004. https://www.thermofisher.com/us/en/home/references/newsletters-and-journals/quest-archive.reg.in.html. The best ratio of the first gene-specific and the second attB primers was 1:10.

Do you have recommended sequencing primers for pDONR201?

We do not offer pre-made primers, but we can recommend the following sequences that can be ordered as custom primers for sequencing of pDONR201:
Forward primer, proximal to attL1: 5'- TCGCGTTAACGCTAGCATGGATCTC
Reverse primer, proximal to attL2: 5'-GTAACATCAGAGATTTTGAGACAC

Can you please list some references for Gateway Cloning Technology?

1. Yeast two-hybrid protein-protein interaction studies Walhout AJ, Sordella R, Lu X, Hartley JL, Temple GF, Brasch MA, Thierry-Mieg N, Vidal M.

2. Protein Interaction Mapping in C. elegans Using Proteins Involved in Vulval Development. Science Jan 7th 2000; 287(5450), 116-122 Davy, A. et al.

3. A protein-protein interaction map of the Caenorhabditis elegans 26S proteosome. EMBO Reports (2001) 2 (9), p. 821-828. Walhout, A.J.M. and Vidal, M. (2001).

4. High-throughput Yeast Two-Hybrid Assays for Large-Scale Protein Interaction mapping. Methods: A Companion to Methods in Enzymology 24(3), pp.297-306

5. Large Scale Analysis of Protein Complexes Gavin, AC et al. Functional Organization of the Yeast Proteome by Systematic Analysis of Protein Complexes. Nature Jan 10th 2002, 415, p. 141-147.

6. Systematic subcellular localisation of proteins Simpson, J.C., Wellenreuther, R., Poustka, A., Pepperkok, R. and Wiemann, S.

7. Systematic subcellular localization of novel proteins identified by large-scale cDNA sequencing. EMBO Reports (2000) 1(3), pp. 287-292.

8. Protein-over expression and crystallography Evdokimov, A.G., Anderson, D.E., Routzahn, K.M. & Waugh, D.S.

9. Overproduction, purification, crystallization and preliminary X-ray diffraction analysis of YopM, an essential virulence factor extruded by the plague bacterium Yersinia pestis. Acta Crystallography (2000) D56, 1676-1679.

10. Evdokimov, et al. Structure of the N-terminal domain of Yersinia pestis YopH at 2.0 A resolution. Acta Crystallographica D57, 793-799 (2001).

11. Lao, G. et al. Overexpression of Trehalose Synthase and Accumulation of Intracellular Trehalose in 293H and 293FTetR:Hyg Cells. Cryobiology 43(2):106-113 (2001).

12. High-throughput cloning and expression Albertha J. M. Walhout, Gary F. Temple, Michael A. Brasch, James L. Hartley, Monique A. Lorson, Sander Van Den Huevel, and Marc Vidal.

13. Gateway Recombinational Cloning: Application to the Cloning of Large Numbers of Open Reading Frames or ORFeomes. Methods in Enzymology, Vol. 328, 575-592.

14. Wiemann, S. et.al., Toward a Catalog of Human Genes and Proteins: Sequencing and Analysis of 500 Novel Complete Protein Coding Human cDNAs, Genome Research (March 2001) Vol. 11, Issue 3, pp.422-435

15. Reviewed in NATURE: Free Access to cDNA provides impetus to gene function work. 15 march 2001, p. 289. Generating directional cDNA libraries using recombination

16. Osamu Ohara and Gary F. Temple. Directional cDNA library construction assisted by the in vitro recombination reaction. Nucleic Acids Research 2001, Vol. 29, no. 4. RNA interference (RNAi)

17. Varsha Wesley, S. et al. Construct design for efficient, effective and highthroughput gene silencing in plants. The Plant Journal 27(6), 581-590 (2001). Generation of retroviral constructs

18. Loftus S K et al. Generation of RCAS vectors useful for functional genomic analyses. DNA Res 31;8(5):221 (2001).

19. James L. Hartley, Gary F. Temple and Michael A. Brasch. DNA Cloning Using In Vitro Site-Specific Recombination. Genome Research (2000) 10(11), pp. 1788-1795.

20. Reboul et al. Open-reading frame sequence tags (OSTs) support the existence of at least 17,300 genes in C. elegans. Nature Genetics 27(3):332-226 (2001).

21. Kneidinger, B. et al. Identification of two GDP-6-deoxy-D-lyxo-4-hexulose reductase synthesizing GDP-D-rhamnose in Aneurinibacillus thermoaerophilus L420-91T*. JBC 276(8) (2001).

What do attL1 and attL2 sites look like after recombination between attB and attP sites?

The attP1 sequence (pDONR) is:
AATAATGATT TTATTTTGAC TGATAGTGAC CTGTTCGTTG CAACAAATTG ATGAGCAATGCTTTTTTAT AATGCCAACT TTGTACAAAA AAGC[TGAACG AGAAACGTAA AATGATATAA ATATCAATAT ATTAAATTAG ATTTTGCATA AAAAACAGACTA CATAATACTG TAAAACACAA CATATCCAGT CACTATGAAT CAACTACTTA GATGGTATTA GTGACCTGTA]

The region within brackets is where the site is "cut" and replaced by the attB1-fragment sequence to make an attL1 site. The sequence GTACAAA is the overlap sequence present in all att1 sites and is always "cut" right before the first G.

The overlap sequence in attP2 sites is CTTGTAC and cut before C. This is attP2:
ACAGGTCACT AATACCATCT AAGTAGTTGA TTCATAGTGA CTGGATATGT TGTGTTTTAC AGTATTATGT AGTCTGTTTT TTATGCAAAA TCTAATTTAA TATATTGATA TTTATATCAT TTTACGTTTC TCGTTCAGCT TTCTTGTACA AAGTTGGCAT TATAAGAAAG CATTGCTTAT AATTTGTTG CAACGAACAG GTCACTATCA GTCAAAATAA AATCATTATT

So, attL1 (Entry Clone) should be:
A ATAATGATTT TATTTTGACT GATAGTGACC TGTTCGTTGC AACAAATTGA TGAGCAATGC TTTTTTATAA TGCCAACT TT G TAC AAA AAA GC[A GGC T]NN NNN

attL2 (Entry Clone) should be:
NNN N[AC C]CA GCT TT CTTGTACA AAGTTGGCAT TATAAGAAAG CATTGCTTAT CAATTTGTTG CAACGAACAG GTCACTATCA GTCAAAATAA AATCATTATT

The sequence in brackets comes from attB, and N is your gene-specific sequence.

Note: When creating an Entry Clone through the BP reaction and a PCR product, the vector backbone is not the same as Gateway Entry vectors. The backbone in the case of PCR BP cloning is pDONR201.

How large can PCR fragments be and still be cloned into a Gateway Entry vector?

There is no size restriction on the PCR fragments if they are cloned into a pDONR vector. The upper limit for efficient cloning into a TOPO adapted Gateway Entry vector is approximately 5 kb. A Gateway recombination reaction can occur between DNA fragments that are as large as 150 kb.

What is the influence of the attB sequence on protein function, solubility, folding, and expression?

Destination vectors that contain N-terminal fusion partners will express proteins that contain amino acids contributed from the attB1 site, which is 25 bases long. This means that in addition to any tag (6x His and/or antibody epitope tag), the N-terminus of an expressed protein will contain an additional 9 amino acids from the attB1 sequence - the typical amino acid sequence is Thr-Ser-Leu-Tyr-Lys-Lys-Ala-Gly-nnn, where nnn will depend on the codon sequence of the insert.

Effects on protein function: A researcher (Simpson et al. EMBO Reports 11(31):287-292, 2000) demonstrated that GFP fusions (N- terminal and C-terminal) localized to the proper intracellular compartment. The expression constructs were generated using Gateway cloning, so the recombinant protein contained the attB1 or attB2 amino acid sequence. The localization function of the cloned recombinant proteins was preserved.

Effects on expression: We have seen no effect of the attB sites on expression levels in E. coli, insect and mammalian cells. The gus gene was cloned into bacterial expression vectors (for native and N-terminal fusion protein expression) using standard cloning techniques and expressed in bacteria. Gus was also cloned into Gateway Destination vectors (for native and N-terminal fusion expression) and expressed. When protein expression is compared, there was no difference in the amount of protein produced. This demonstrates that for this particular case, the attB sites do not interfere with transcription or translation.

Effects on solubility: A researcher at the NCI has shown that Maltose Binding Protein fusions constructed with Gateway Cloning were soluble. The fusion proteins expressed had the attB amino acid sequence between the Maltose Binding Protein and the cloned protein. It is possible that some proteins containing the attB sequence could remain insoluble when expressed in E.coli.

Effects on folding: Two Hybrids screens show the same interacters identified with and without the attB sequence. Presumably correct protein folding would be required for protein-protein interactions to take place. It is possible that some proteins containing the attB sequence may not fold correctly.

Must PCR conditions be changed once the original PCR primers have attB sequence added to them?

Since the attB sequences are on the 5' end of oligos, they will not anneal to the target template in the first round of PCR. Sometimes the PCR product is more specific with the attB primers, probably due to the longer annealing sequence (all of attB plus gene specific sequence) after the first round of amplification. Generally there is no need to change PCR reaction conditions when primers have the additional attB sequence

What is the smallest quantity of RNA detectable by the SuperScript IV First-Strand System for RT-PCR?

Detection limits dependend on many factors, including primer design, target size, and the abundance of mRNA. The recommended template amount when working with SuperScript IV Reverse Transcriptase is 10 pg-5 µg total RNA or 10 pg-500 ng mRNA.

What size targets can be amplified by the SuperScript One-Step RT-PCR Systems?

The SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase is recommended for amplifying RNA targets up to 4.5 kb and the SuperScript IV UniPrime One-Step RT-PCR System is recommended for amplifying RNA targets up to 13 kb.

Can PCR primers be tailed directly with attL sites for direct recombination into the destination vector?

No, this is not really feasible due to the fact that the attL sequence is approximately 100 bp, which is too long for efficient oligo synthesis. Our own maximum sequence length for ordering custom primers is 100 nucleotides. In contrast, the attB sequences are only 25 bp long, which is a very reasonable length for adding onto the 5' end of gene-specific PCR primers.

How stable are your cationic lipids that are used in transfection?

All the following lipids are stable at 4º C for at least one year:
11668-019 Lipofectamine 2000
10362-100 Cellfectin II
10459-014 DMRIE-C
10964-013 Lipofectamine PLUS
18292-011 Lipofectin
18324-012 Lipofectamine

Where can I get Gateway vector sequences and maps?

Vector information can be found in the product manuals or directly on our web site by entering the catalog number of the product in the search box. The vector map, cloning site diagram, and sequence information will be linked to the product page.

From where does Gateway get its lambda nomenclature, and is it consistent with textbook nomenclature for lambda recombination?

The Gateway nomenclature is consistent with lambda nomenclature, but we use numbers to differentiate between modified versions of the att sites (attB1, attB2, attP1, attP2, and so on). We have introduced mutations in the att sites to provide specificity and directionality to the recombination reaction. For example, attB1 will only recombine with attP1 and not with attP2.

What is the first step in an experiment with the Gateway system?

The first step is to create an Entry clone for your gene of interest. We have 3 options to do this: The first is by BP recombination reaction using the PCR Cloning System with Gateway Technology. This is recommended for cloning large (>5 kb) PCR products. We also have Gateway compatible TOPO Cloning vectors such as pCR8/GW/TOPO and pENTR/D-TOPO. The final option is to use restriction enzymes to clone into a pENTR Dual Selection vector.

What are the prerequisites for Gateway cloning and expression?

The gene of interest must be flanked by the appropriate att sites, either attL (100 bp) in an Entry clone or attB (25 bp) in a PCR product. For Entry clones, everything between the attL sites will be shuttled into the Gateway destination vector containing attR sites, and a PCR product flanked by attB sites must be shuttled into an attP-containing donor vector such as pDONR221.

The location of translation initiation sites, stop codons, or fusion tags for expression must be considered in your initial cloning design. For example, if your destination vector contains an N-terminal tag but does not have a C-terminal tag, the vector should already contain the appropriate translation start site but the stop codon should be included in your insert.

Will increasing the Gateway cloning reaction time improve recombination efficiency?

Yes, increasing the incubation time from 1 hour to 4 hours will generally increase colony numbers 2-3 fold. An overnight incubation at room temperature will typically increase colony yield by 5-10 fold.

How many times can I thaw BP Clonase II and LR Clonase II?

BP Clonase II and LR Clonase II can be freeze/thawed at least 10 times without significant loss of activity. However, you may still want to aliquot the enzymes to keep freeze/thaw variability to a minimum.

These enzymes are more stable than the original BP and LR Clonase and can be stored at -20 degrees C for 6 months.

How clean must my DNA be to use in a Gateway cloning reaction?

Mini-prep (alkaline lysis) DNA preparations work well in Gateway cloning reactions. It is important that the procedure remove contaminating RNA for accurate quantification. Plasmid DNA purified with our S.N.A.P. nucleic acid purification kits, ChargeSwitch kits, or PureLink kits are recommended.

How would you incorporate a leader sequence for secretion into an entry vector?

A simple way to express a protein with a leader sequence is to have the leader sequence encoded in the destination vector. The other option is to have the leader sequence subcloned into the entry vector using restriction enzymes, or incorporate the leader sequence into the forward PCR primer when cloning a PCR product into the entry vector. Please see Esposito et al. (2005), Prot. Exp. & Purif. 40, 424-428 for an example of how a partial leader sequence for secretion was incorporated into an entry vector.

Where is the ATG relative to the 5' attB site in a Gateway expression clone?

This depends on whether you are expressing a fusion or a native protein in the Gateway destination vector. For an N-terminal fusion protein the ATG will be given by the destination vector and it will be upstream of the attB1 site. For a C-terminal fusion protein or a native protein, the ATG should be provided by your gene of interest, and it will be downstream of the attB1 site.

Are the Gateway attB1 and attB2 sites the same as the attB site used for recombination into E. coli by bacteriophage lambda?

The Gateway attB sites are derived from the bacteriophage lambda site-specific recombination, but are modified to remove stop codons and reduce secondary structure. The core regions have also been modified for specificity (i.e., attB1 will recombine with attP1 but not with attP2).

Will Gateway att sites affect the expression of my protein?

Expression experiments have shown that the extra amino acids contributed by the attB site to a fusion protein will most likely have no effect on protein expression levels or stability. In addition, they do not appear to have any effect on two-hybrid interactions in yeast. However, as is true with the addition of any extra sequences that result from tags, the possible effects will be protein-dependent.

Can the attB primers anneal in a non-specific manner?

No, attB primers are highly specific under standard PCR conditions. We have amplified from RNA (RT-PCR), cDNA libraries, genomic DNA, and plasmid templates without any specificity problems.

What is the smallest fragment that can be used in a Gateway reaction?

The smallest size we have recombined is a 70 bp piece of DNA located between the att sites. Very small pieces are difficult to clone since they negatively influence the topology of the recombination reaction.

Are there any limitations on the insert length in Gateway cloning?

There is no theoretical size limitation. PCR products between 100 bp and 11 Kb have been readily cloned into a pDONR Gateway vector. Other DNA pieces as large as 150 kb with att sites will successfully recombine with a Gateway-compatible vector. Overnight incubation is recommended for large inserts.

What primer purity should be used for adding attB sites to my PCR product?

Standard desalted purity is generally sufficient for creating attB primers. We examined HPLC-purified oligos for Gateway cloning (about 50 bp long) and found only about a 2-fold increase in colony number over standard desalted primers. If too few colonies are obtained, you may try to increase the amount of PCR product used and/or incubate the BP reaction overnight.

Can I sequence a peptide that is acetylated or biotinylated?

No. These groups effectively block the N terminus.


For Research Use Only. Not for use in diagnostic procedures.

Título del producto
Seleccione un problema

Al hacer clic en Enviar, acepta que Fisher Scientific se ponga en contacto con usted en relación con los comentarios que ha proporcionado en este formulario. No compartiremos su información para ningún otro fin. Toda la información de contacto proporcionada se mantendrá de acuerdo con nuestra Política de Privacidad. Política de privacidad.